Molecular markers associated with thrombotic events in Ph-negative myeloproliferative neoplasms
Original Article

Molecular markers associated with thrombotic events in Ph-negative myeloproliferative neoplasms

Tatiana Makarik1 ORCID logo, Irina Fevraleva1 ORCID logo, Elena Nikulina1 ORCID logo, Elena Stepanova1 ORCID logo, Svetlana Treglazova1 ORCID logo, Alina Makarik2 ORCID logo, Anton Morozov1, Irina Subortseva1 ORCID logo, Manana Sokolova1 ORCID logo, Alina Kokhno1 ORCID logo, Anait Melikian1 ORCID logo, Nadezhda Zozulia1 ORCID logo, Sergei Kulikov1 ORCID logo, Andrey Sudarikov1 ORCID logo

1National Medical Research Center for Hematology, Moscow, Russia; 2Pirogov Russian National Research Medical University, Moscow, Russia

Contributions: (I) Conception and design: T Makarik, S Kulikov, A Sudarikov; (II) Administrative support: A Kokhno, A Melikian; (III) Provision of study materials or patients: A Morozov, I Subortseva, M Sokolova; (IV) Collection and assembly of data: T Makarik, I Fevraleva, E Nikulina, E Stepanova, S Treglazova, A Makarik; (V) Data analysis and interpretation: N Zozulia, S Kulikov, T Makarik; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Andrey Sudarikov, PhD. Head of Molecular Genetics Department, National Medical Research Center for Hematology, Novy Zykovski Lane 4a, 125167 Moscow, Russia. Email: dusha@blood.ru.

Background: Risk factors for thrombosis in patients with chronic myeloproliferative neoplasms (MPNs) include erythrocytosis, leukocytosis, and the V617F mutation in the JAK2 gene. Hereditary risk factors such as factor V (FV) G1691A or prothrombin (FII) G20210A gene mutations also play an important role in the development of thrombosis. The high prevalence of these genetic risk factors among the general population suggests that they may be present in a significant number of MPN patients and could increase their risk of thrombosis. The aim of this study is to investigate the association between certain markers of thrombophilia and an increased risk of thrombotic events in patients with myeloproliferative disorders, using extensive retrospective data.

Methods: This study included patients who attended the National Medical Research Center of Hematology in Moscow, Russia between November 2016 and February 2023 and had their hereditary thrombophilia markers evaluated using polymerase chain reaction (PCR). Among the whole cohort of 4,197 patients, 367 had confirmed MPN diagnosis (139 men and 228 women). The median age of the patients was 48 years, with a range from 18 to 84 years. We compared the frequency of thrombotic events between groups of patients with different combinations of hereditary risk factors and MPN diagnosis status. Frequency analysis methods, including conjugacy tables and Fisher’s exact test, were used to analyze the data.

Results: There were no significant differences in the occurrence of FV G1691A and FII G20210A mutations between the comparison groups. However, the presence of Thr165Met mutation in the FII gene was found to be associated with an increased risk of thrombotic complications in a study group of patients with MPNs [21.6% vs. 12.4%; Pχ2=0.02; odds ratio (OR) =1.95].

Conclusions: A synergistic effect between MPN diagnosis and the Thr165Met mutation in the FII gene on thrombosis was identified. FII Thr165Met testing might be considered when prescribing appropriate antithrombotic and antiplatelet therapies for patients with MPN.

Keywords: Chronic myeloproliferative neoplasms (chronic MPNs); factor V Leiden (FV Leiden); prothrombin gene mutations (FII gene mutations); thrombotic events


Received: 27 December 2024; Accepted: 14 April 2025; Published online: 27 May 2025.

doi: 10.21037/aob-24-35


Highlight box

Key findings

• The presence of the Thr165Met mutation in the FII gene is associated with an increased risk of thrombotic events in myeloproliferative neoplasm (MPN) patients.

What is known and what is new?

• The thrombogenic potential of the Thr165Met mutation in the FII gene has not been conclusively established for the general population.

• We have found a synergistic effect on thrombosis between the presence of Thr165Met mutation in the FII gene and MPN diagnosis.

What is the implication, and what should change now?

• Testing for the Thr165Met variant allele of the FII gene may be useful in assessing the risk of thrombotic events in patients with MPN.


Introduction

Significant progress has been made in understanding the molecular basis of myeloproliferative neoplasms (MPNs) through the identification of several genetic defects, with the most significant being somatic mutations in the JAK2, CALR, and MPL genes. These mutations, which are associated with the molecular pathogenesis of these diseases, affect proteins that play a crucial role in transmitting proliferative signals and are a hallmark of this group of hematopoietic system disorders. JAK2 V617F mutation is found in approximately 90–95% of patients with polycythemia vera (PV), 50–70% of those with essential thrombocythemia (ET), and 40–50% with primary myelofibrosis (PMF) (1-5). Mutations in the CALR gene occur in up to 67–88% of ET and PMF patients with non-mutated JAK2, while mutations in the MPL gene occur in only 5–10% of these patients and are exceedingly rare in PV patients (6,7). It is known that myeloproliferative disorders are often accompanied by adverse vascular events, such as arterial and venous thrombosis and bleeding. These events are most commonly associated with the V617F mutation in the JAK2 gene, rather than mutations in CALR or MPL genes (8-12). On the other hand, mutations in genes that code for blood clotting factors and enzymes involved in the folate cycle and fibrinolytic system, can increase the risk of thrombosis and its recurrence. These include mutations in prothrombin (FII) gene and factor V (FV) gene (13,14).

The Leiden mutation (FV G1691A) has been linked with resistance to protein C anticoagulant effects. The FII G20210A polymorphism, on the other hand, is associated with higher levels of plasma prothrombin. A substitution of guanine for adenine at the 20,210 position in the 3’-untranslated region of the FII gene increases mRNA abundance, ultimately leading to an increase in prothrombin concentration. These two genetic variations are considered to be more common causes of thrombophilia than deficiencies in antithrombin, protein C, or protein S (15-17).

There is another variant of the FII gene mutation—FII Thr165Met (T165M, C494T, rs5896), which is located in a highly conserved region of exon 6. There are limited data regarding the association between T165M mutation and the occurrence of thrombotic complications. However, it was found that the presence of the C494T allele in the FII gene among patients with coronavirus disease 2019 (COVID-19) significantly increased the risk of thrombotic events despite taking anticoagulant medication (18-20).

The high prevalence of genetic markers for hereditary thrombophilia among the general population suggests that a significant number of patients with MPN may have these markers. However, studies on the potential impact of these polymorphisms on thrombotic risk among MPN patients have yielded conflicting results (21,22).

The aim of our study was to evaluate the impact of genetic markers for hereditary thrombophilia on the risk of thrombotic events in patients with MPNs. We present this article in accordance with the STREGA reporting checklist (available at https://aob.amegroups.com/article/view/10.21037/aob-24-35/rc).


Methods

The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Institutional Ethics Committee of the National Medical Research Center for Hematology, Moscow, Russia (protocol code 180; date of approval 30.05.2024) and individual consent for this retrospective analysis was waived.

Patient selection and data collection

Samples of patients who attended the National Medical Research Center for Hematology between November 2016 and February 2023 were included in a retrospective study. The structure of datasets used for analysis is presented in Figure 1. DNA isolated from the blood samples of 4,197 patients were tested for hereditary thrombophilia markers (FV G1691A, FII G20210A). Electronic data records for these patients were searched for the occurrence of certain “thrombotic” keywords, including: thrombosis, pulmonary embolism, thromboembolism, venous thromboembolic complications, postthrombophlebitic disease, portal hypertension, heart attack, ischemic type of stroke, acute cerebrovascular accident, occlusion, thromboextraction, thrombolytic therapy, thrombolysis, transient ischemic attack, bone necrosis. The search yielded a group of patients [439] whose medical records contained specific keywords. After a thorough analysis of appropriate medical records by clinical experts, 43 patients of these 439 were excluded from the analysis since thrombotic events were not confirmed.

Figure 1 Structure of the dataset. MPN, myeloproliferative neoplasm.

Requests for JAK2, CALR, and MPL evaluation according to the World Health Organization (WHO) 2022 guidelines (23) might be interpreted as a possible indication of MPN presence. Therefore, we have identified 767 patients who were tested for the mutations in the JAK2, CALR, and MPL genes as a group suspected of having MPNs. After an expert evaluation of their clinical records, MPN diagnosis was confirmed for 367 of these patients, and for the remaining 400 patients, MPN diagnosis was excluded. The group with a confirmed MPN diagnosis consisted of 139 men and 228 women. The median age of the patients was 48 years, with a range from 18 to 84 years.

Molecular genetic analysis

DNAs and RNAs were extracted from 5 to 10 mL of blood or bone marrow using standard salt extraction method (24) or “Ribosol-D” kit (Interlabservice, Moscow, Russia). The JAK2 V617F mutation was detected using a reagent kit from Syntol (Moscow, Russia). MPL W515L/K mutations were assessed using a reagent kit also from Syntol. The Rotor-Gene (Qiagene, Hamburg, Germany) apparatus was used for polymerase chain reaction (PCR) amplification. Exon 9 deletions/insertions in the CALR gene were analyzed using fragment analysis with a minimum sensitivity of 3%. All samples were tested for Ph negativity with a combination of reagent kits “Reverta-L” and “Amplification Variant FRT” (Interlabservice). The analysis of genetic mutations in thrombophilia markers, including FII G20210A, FV G1691A, as well as FII Thr165Met, was performed using allele-specific PCR (AS-PCR) on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). AS-PCR conditions: preheating: 94 ℃, 300 s; thermal cycling: 45 cycles; denaturation: 94 ℃, 20 s; annealing and elongation: 60 ℃, 50 s; each primer quantity 10 pm/per reaction; each probe quantity 5 pm/per reaction; reaction volume: 25 µL. PCR master mix (buffer, MgCl2, dNTP, Taq-polymerase) was provided by Syntol. All primers and Taqman probes were synthesized by Syntol according to our design (see Table 1).

Table 1

Mutation points, primers and fluorescent Taqman probes

Target gene Nucleotide mutation/amino acid substitution/NCBI SNP Primer/probe Sequence (5' to 3')
FV G1691A/Arg506Gln/rs6025 Forward GACATCGCCTCTGGGCTA
Reverse w CAAGGACAAAATACCTGTATTCCAC
Reverse mt CAAGGACAAAATACCTGTATTCCAT
Probe (FAM)GCCTGTCCAGGGAT(BHQ1)CTGCTCTTAC
FII G20210A/–/rs1799963 Forward TGGAACCAATCCCGTGAAAGAA
Reverse w ACTGGGAGCATTGAGGATC
Reverse mt ACTGGGAGCATTGAGGATT
Probe (ROX)GAGAGTCACTTTTATTGGGAACCATAG(BHQ2)
C494T/Thr165Met/rs5896 Forward w ACCCCGACAGCAGCACCTC
Forward mt ACCCCGACAGCAGCACCTT
Reverse AGCTTACCACAGACAGGGATG
Probe (Cy5)GTGCTACACTACAGACCCCACCGTGA(RTQ2)
MTHFR C677T/Ala222Va/rs1801133 Forward w GAGAAGGTGTCTGCGGGATC
Forward mt GAGAAGGTGTCTGCGGGATT
Reverse CATGCCTTCACAAAGCGGAAG
Probe (R&G)GATTTCATCATCACGCAGCTTTTCTTTGAGGCTG(BQH2)
A1298C/Glu429Ala/rs1801131 Forward w GGAGGAGCTGACCAGTGAACA
Forward mt GAGGAGCTGACCAGTGAACC
Reverse GTGACCATTCCGGTTTGGTTCT
Probe (ROX)GTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAG(BQH2)
PAI-I 675 5G>4G/–/rs1799889 Forward w AGTCTGGACACGTGGGTG
Forward mt AGTCTGGACACGTGGGTA
Reverse CAGCCACGTGATTGTCTAGG
Probe (Cy5)AGCCGTGTATCATCGGAGGCGG(BHQ2)

FII, prothrombin; FV, factor V; mt, mutated; NCBI, National Center for Biotechnology Information; SNP, single nucleotide polymorphism; w, wild type.

Statistical analysis

All three datasets (genotypes of thrombophilia markers, history of thrombotic events, and the presence of MPN diagnosis) were merged into a single analysis file by patients ID (see table available at https://cdn.amegroups.cn/static/public/aob-24-35-1.xls). The indicator for thrombotic events was set to 0 for all patients except those who had such an event, which were included in a second data set as confirmed by an expert physician. Patients treated at our center receive a comprehensive range of diagnostic and treatment services in accordance with internationally recognized clinical guidelines. Therefore, myocardial infarction was confirmed by electrocardiogram, deep vein thrombosis by ultrasound, pulmonary embolism by tomography, etc. The demographic characteristics of the study sample are presented in Table 2. It should be noted that, despite the initial analysis of the clinical data set was conducted using computer-assisted keyword searching, only cases that were manually verified by clinical experts were included in the subsequent association analysis. Clinical and laboratory records were extracted from the medical and laboratory databases and imported into Statistical Analysis Software (SAS) datasets. These datasets were then sorted, processed, and combined into an analysis file using DATA Step programming tools in SAS (25). Descriptive statistics and frequency analyses were performed on the combined data sets in order to estimate associations.

Table 2

Demographic characteristics of the study sample

Characteristics All No MPN verified MPN diagnosis verified
Number 4,197 400 367
Age (years), median [range] 42 [18–87] 46 [18–83] 48 [18–84]
Gender, n (%)
   M 1,839 (43.82) 193 (48.25) 139 (37.87)
   F 2,358 (56.18) 207 (51.75) 228 (62.13)
Diagnosis, n (%)
   PV 102 (27.79)
   ET 66 (17.98)
   PMF 60 (16.35)
   Other MPN 139 (37.87)
Thrombotic events, n (%)
   Yes 396 (9.44) 32 (8.00) 57 (15.53)
   No 3,801 (90.56) 368 (92.00) 310 (84.47)

ET, essential thrombocythemia; F, female; M, male; MPN, myeloproliferative neoplasm; PMF, primary myelofibrosis; PV, polycythemia vera.


Results

We have found no essential difference in the occurrence of hereditary thrombophilia gene mutations between our general group of patients (n=4,197) and the data published elsewhere (26-28). The complete genotype distribution for 4,197 patients is provided in Table S1. FII G20210A, FV G1691A, and FII Thr165Met variant alleles were found in 3.14%, 5.17%, and 31.86%, respectively. Of the 4,197 patients, 396 (9.44%) had a history of thrombotic events, including heart attacks, thrombosis, PE, and other circulatory disorders. The distribution of 367 patients with a confirmed diagnosis of MPNs established according to the WHO diagnostic criteria (29,30) is as follows: PV 27.79% (n=102), ET 17.98% (n=66), PMF 16.35% (n=60); MPN not otherwise specified 37.87% (n=139). Thrombotic events in patients with the JAK2 V617F gene mutation were observed in 17.3% (44/255). Thrombotic events in patients with CALR and MPL gene mutations occurred in 7.5% (4/53) and 50% (3/6), respectively. No significant differences were found in the occurrence of FII G20210A, and FV G1691A gene mutations between the general population and patients with confirmed MPNs. Treatment for MPNs involves assessing thrombotic risk to prevent thrombotic complications. Therefore, it is plausible that prescribed anticoagulant therapy compensates for the prothrombotic effects of hereditary thrombophilia gene mutations in these patients. Additionally, the data were analyzed for the group of patients suspected of having an MPN (n=767). We found a synergistic effect between MPN diagnosis and the presence of the FII C494T (Thr165Met) mutation. The risk of thrombotic complications in these cases was nearly twofold higher compared to patients without an MPN diagnosis (Figure 2). This difference was statistically significant [21.6% vs. 12.4%; Pχ2=0.02; odds ratio (OR) =1.95; 95% confidence interval (CI): 1.10–3.45]. In the overall cohort of patients (n=4,197), no significant correlation between the FII Thr165Met mutation and thrombotic events was found (Pχ2=0.70; OR =1.05; 95% CI: 0.83–1.34) (Tables 3,4).

Figure 2 Association of thrombotic events with thrombophilia molecular markers (FII T165M, FII G20210A, and FV G1691A) in patients with MPNs. CI, confidence interval; FII, prothrombin; FV, factor V; MPN, myeloproliferative neoplasm; OR, odds ratio.

Table 3

FII Thr165Met mutation in MPN patients with or without thrombotic events

FII Thr165Met Total Thrombotic events
No Yes
No 242 212 (87.60) 30 (12.40)
Yes 125 98 (78.40) 27 (21.60)
Total 367 310 57

Data are presented as number or number (%). FII, prothrombin; MPN, myeloproliferative neoplasm.

Table 4

FII Thr165Met mutation in overall cohort of patients with or without thrombotic events

FII Thr165Met Total Thrombotic events
No Yes N/A
No 2,859 2,643 (92.44) 216 (7.56) 0
Yes 1,338 1,232 (92.08) 106 (7.92) 0
N/A 92 5 (5.43) 74 (80.43) 13 (14.13)
Total 4,289 3,880 396 13

Data are presented as number or number (%). FII, prothrombin; N/A, not available.


Discussion

Currently, limited data are available regarding the clinical significance of the FII C494T mutation (Thr165Met). The impact of this mutation on the development of urolithiasis, Usher syndrome, and miscarriage has been confirmed in several studies (31-34). A relationship between this polymorphism and familial thrombosis has also been reported (19,20). These studies describe patients who are homozygous or heterozygous for the FII Thr165Met mutation, leading us to evaluate both heterozygous and homozygous variants of this mutation as potential genetic markers for thrombophilia.

The prothrombinase complex, which includes phospholipids, Ca2+ ions, and coagulation FV and factor Xa plays a key role in coagulation by converting prothrombin into thrombin. Coagulation factor Xa is a proteolytic enzyme that acts as the active component of prothrombinase. This enzyme cleaves approximately half of the prothrombin molecule, causing the loss of 3/4 of its carbohydrates. Thrombin has both pro- and anti-coagulant properties, making it an important regulator of blood clotting. Exon 6 of the FII codes for a Kringle domain, which plays a crucial role in protein-protein interactions involved in blood clotting. The C494T mutation in FII exon 6 results in the substitution of the amino acid threonine (Thr) with methionine (Met) at position 165 (35,36). This amino acid substitution can affect interactions between proteins involved either in coagulation or anticoagulation. Antithrombin III is one of these factors. It can be speculated that changes in the functional domain, specifically those caused by the C494T (Thr165Met) mutation, prevent the thrombin-antithrombin III interaction and can lead to thrombosis, even in the presence of anticoagulants.

Here we present data concerning a synergistic effect between MPN diagnosis and the Thr165Met mutation in the FII gene on thrombosis. However, our study has certain limitations. The main limitation was that only past medical events were tracked and confirmed based on medical records. We understand this, but we used all available information derived from existing medical records for this retrospective research. It should also be noted that the control group, which was formed from patients at the same hematology center, does not represent a general population. However, this approach was deemed appropriate for the study’s objective, which was to compare two patient groups from the same clinical setting, differing primarily by MPN status. Selection bias was minimized, as we included all patients who had thrombophilia markers tested during the specified time period. Group formation was also based on objective parameters and was not influenced by the researchers.

Therefore, a possible link is assumed between the presence of the C494T mutation (Thr165Met) in the FII gene and thrombosis in patients with MPNs who are receiving anticoagulant therapy. Further research should clarify this association and help determine optimal anticoagulant treatment strategies in these patients.


Conclusions

The presence of the Thr165Met mutation in the FII gene was found to be associated with an increased risk (OR =1.95; Pχ2=0.02) of thrombotic events in patients MPNs. It should be noted that the high incidence of Thr165Met variant allele (31.86%) indicates that our findings need to be confirmed on a larger sample of patients. However, the significance of certain molecular markers as predictive factors for assessing thrombotic risk and prescribing appropriate antiplatelet and anticoagulant therapy in patients with Ph-negative MPNs should not be overlooked.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the STREGA reporting checklist. Available at https://aob.amegroups.com/article/view/10.21037/aob-24-35/rc

Data Sharing Statement: Available at https://aob.amegroups.com/article/view/10.21037/aob-24-35/dss

Peer Review File: Available at https://aob.amegroups.com/article/view/10.21037/aob-24-35/prf

Funding: None.

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://aob.amegroups.com/article/view/10.21037/aob-24-35/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Institutional Ethics Committee of the National Medical Research Center for Hematology, Moscow, Russia (protocol code 180; date of approval 30.05.2024) and individual consent for this retrospective analysis was waived.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Vainchenker W, Kralovics R. Genetic basis and molecular pathophysiology of classical myeloproliferative neoplasms. Blood 2017;129:667-79. [Crossref] [PubMed]
  2. Grinfeld J, Nangalia J, Green AR. Molecular determinants of pathogenesis and clinical phenotype in myeloproliferative neoplasms. Haematologica 2017;102:7-17. [Crossref] [PubMed]
  3. Rumi E, Harutyunyan AS, Pietra D, et al. LNK mutations in familial myeloproliferative neoplasms. Blood 2016;128:144-5. [Crossref] [PubMed]
  4. Rumi E, Pietra D, Pascutto C, et al. Clinical effect of driver mutations of JAK2, CALR, or MPL in primary myelofibrosis. Blood 2014;124:1062-9. [Crossref] [PubMed]
  5. Tefferi A, Vainchenker W. Myeloproliferative neoplasms: molecular pathophysiology, essential clinical understanding, and treatment strategies. J Clin Oncol 2011;29:573-82. [Crossref] [PubMed]
  6. Klampfl T, Gisslinger H, Harutyunyan AS, et al. Somatic mutations of calreticulin in myeloproliferative neoplasms. N Engl J Med 2013;369:2379-90. [Crossref] [PubMed]
  7. Nangalia J, Massie CE, Baxter EJ, et al. Somatic CALR mutations in myeloproliferative neoplasms with nonmutated JAK2. N Engl J Med 2013;369:2391-405. [Crossref] [PubMed]
  8. Kc D, Falchi L, Verstovsek S. The underappreciated risk of thrombosis and bleeding in patients with myelofibrosis: a review. Ann Hematol 2017;96:1595-604. [Crossref] [PubMed]
  9. Tanashyan MM, Kuznetsova PI, Subortseva IN, et al. Chronic and acute cerebrovascular pathology in patients with Ph-negative myeloproliferative diseases. Gematol Transfuziol 2019;61:146-50.
  10. Melikyan AL, Sukhanova GA, Vakhrusheva MV, et al. Experience in treating portal thromboses in patients with chronic myeloproliferative diseases. Ter Arkh 2016;88:89-95. [Crossref] [PubMed]
  11. Bertozzi I, Peroni E, Coltro G, et al. Thrombotic risk correlates with mutational status in true essential thrombocythemia. Eur J Clin Invest 2016;46:683-9. [Crossref] [PubMed]
  12. Barbui T, Finazzi G, Falanga A. Myeloproliferative neoplasms and thrombosis. Blood 2013;122:2176-84. [Crossref] [PubMed]
  13. Koloskov AV, Chernova EV, Mechnikov II. Clinical significance of factor V and prothrombin genes polymorphism. Gematol Transfuziol 2018;63:250-7.
  14. Miranda-Vilela AL. Role of polymorphisms in factor V (FV Leiden), prothrombin, plasminogen activator inhibitor type-1 (PAI-1), methylenetetrahydrofolate reductase (MTHFR) and cystathionine β-synthase (CBS) genes as risk factors for thrombophilias. Mini Rev Med Chem 2012;12:997-1006. [Crossref] [PubMed]
  15. Spronk HM, Govers-Riemslag JW, ten Cate H. The blood coagulation system as a molecular machine. Bioessays 2003;25:1220-8. [Crossref] [PubMed]
  16. Sachchithananthan M, Stasinopoulos SJ, Wilusz J, et al. The relationship between the prothrombin upstream sequence element and the G20210A polymorphism: the influence of a competitive environment for mRNA 3’-end formation. Nucleic Acids Res 2005;33:1010-20. [Crossref] [PubMed]
  17. Roshani S. Venous and arterial thrombosis: associations and risk factors. 2012. Available online: https://hdl.handle.net/1887/18334
  18. Fevraleva I, Mamchich D, Vinogradov D, et al. Role of Genetic Thrombophilia Markers in Thrombosis Events in Elderly Patients with COVID-19. Genes (Basel) 2023;14:644. [Crossref] [PubMed]
  19. Sun G, Jia Y, Meng J, et al. A genetic risk factor for thrombophilia in a Han Chinese family. Mol Med Rep 2017;15:1668-72. [Crossref] [PubMed]
  20. Ge XH, Zhu F, Wang BL, et al. Association between prothrombin gene polymorphisms and hereditary thrombophilia in Xinjiang Kazakhs population. Blood Coagul Fibrinolysis 2014;25:114-8. [Crossref] [PubMed]
  21. Afshar-Kharghan V, López JA, Gray LA, et al. Hemostatic gene polymorphisms and the prevalence of thrombotic complications in polycythemia vera and essential thrombocythemia. Blood Coagul Fibrinolysis 2004;15:21-4. [Crossref] [PubMed]
  22. Ruggeri M, Gisslinger H, Tosetto A, et al. Factor V Leiden mutation carriership and venous thromboembolism in polycythemia vera and essential thrombocythemia. Am J Hematol 2002;71:1-6. [Crossref] [PubMed]
  23. Li W. The 5th Edition of the World Health Organization Classification of Hematolymphoid Tumors. In: Li W, editor. Leukemia. Brisbane: Exon Publications; 2022: Chapter 1.
  24. Barton DE. DNA prep for eukaryotic cells (macrophages)? 1995. Available online: http://www.bio.net/bionet/mm/methods-and-reagents/1995-July/031231.html
  25. SAS Institute Inc. SAS® 9.4. Cary: SAS Institute Inc.; 2016.
  26. Manderstedt E, Lind-Halldén C, Halldén C, et al. Classic Thrombophilias and Thrombotic Risk Among Middle-Aged and Older Adults: A Population-Based Cohort Study. J Am Heart Assoc 2022;11:e023018. [Crossref] [PubMed]
  27. Saadatnia M, Salehi M, Movahedian A, et al. Factor V Leiden, factor V Cambridge, factor II GA20210, and methylenetetrahydrofolate reductase in cerebral venous and sinus thrombosis: A case-control study. J Res Med Sci 2015;20:554-62. [Crossref] [PubMed]
  28. Russo PD, Damante G, Pasca S, et al. Thrombophilic mutations as risk factor for retinal vein occlusion: a case-control study. Clin Appl Thromb Hemost 2015;21:373-7. [Crossref] [PubMed]
  29. Duangnapasatit B, Rattarittamrong E, Rattanathammethee T, et al. Clinical Manifestations and Risk Factors for Complications of Philadelphia Chromosome-Negative Myeloproliferative Neoplasms. Asian Pac J Cancer Prev 2015;16:5013-8. [Crossref] [PubMed]
  30. Arber DA, Orazi A, Hasserjian R, et al. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 2016;127:2391-405. [Crossref] [PubMed]
  31. Rungroj N, Nettuwakul C, Sawasdee N, et al. Correlation between genotypes of F2 rs5896 (p.Thr165Met) polymorphism and urinary prothrombin fragment 1. Urolithiasis 2018;46:405-7. [Crossref] [PubMed]
  32. Rungroj N, Sudtachat N, Nettuwakul C, et al. Association between human prothrombin variant (T165M) and kidney stone disease. PLoS One 2012;7:e45533. [Crossref] [PubMed]
  33. Rong W, Chen X, Zhao K, et al. Novel and recurrent MYO7A mutations in Usher syndrome type 1 and type 2. PLoS One 2014;9:e97808. [Crossref] [PubMed]
  34. Qu C, Liang F, Long Q, et al. Genetic screening revealed usher syndrome in a paediatric Chinese patient. Hearing Balance Commun 2017;15:98-106. [Crossref] [PubMed]
  35. Walker RK, Krishnaswamy S. The activation of prothrombin by the prothrombinase complex. The contribution of the substrate-membrane interaction to catalysis. J Biol Chem 1994;269:27441-50. [Crossref] [PubMed]
  36. Haynes LM, Bouchard BA, Tracy PB, et al. Prothrombin activation by platelet-associated prothrombinase proceeds through the prethrombin-2 pathway via a concerted mechanism. J Biol Chem 2012;287:38647-55. [Crossref] [PubMed]
doi: 10.21037/aob-24-35
Cite this article as: Makarik T, Fevraleva I, Nikulina E, Stepanova E, Treglazova S, Makarik A, Morozov A, Subortseva I, Sokolova M, Kokhno A, Melikian A, Zozulia N, Kulikov S, Sudarikov A. Molecular markers associated with thrombotic events in Ph-negative myeloproliferative neoplasms. Ann Blood 2025;10:7.

Download Citation